resource source identifier chemicals Search Results


86
Jackson Laboratory resource source identifier mouse
Resource Source Identifier Mouse, supplied by Jackson Laboratory, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/resource+source+identifier+chemicals/pm42090287-249-2-13?v=Jackson+Laboratory
Average 86 stars, based on 1 article reviews
resource source identifier mouse - by Bioz Stars, 2026-08
86/100 stars
  Buy from Supplier

86
Nacalai resource source identifier chemicals
Resource Source Identifier Chemicals, supplied by Nacalai, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/resource+source+identifier+chemicals/pm42030952-121-2-11?v=Nacalai
Average 86 stars, based on 1 article reviews
resource source identifier chemicals - by Bioz Stars, 2026-08
86/100 stars
  Buy from Supplier

86
Servicebio Inc resource source identifier mouse anti-ki67 mab servicebio cat#gb121141
Resource Source Identifier Mouse Anti Ki67 Mab Servicebio Cat#Gb121141, supplied by Servicebio Inc, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/resource+source+identifier+chemicals/pm42309065-274-2-9?v=Servicebio+Inc
Average 86 stars, based on 1 article reviews
resource source identifier mouse anti-ki67 mab servicebio cat#gb121141 - by Bioz Stars, 2026-08
86/100 stars
  Buy from Supplier

86
Merck & Co resource source identifier chemicals
Resource Source Identifier Chemicals, supplied by Merck & Co, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/resource+source+identifier+chemicals/10__1016_slash_j__isci__2025__113899-368-2-11?v=Merck+%26+Co
Average 86 stars, based on 1 article reviews
resource source identifier chemicals - by Bioz Stars, 2026-08
86/100 stars
  Buy from Supplier

86
Synthego Inc resource source identifier oligonucleotides gccgtttaagaagatccctg
Resource Source Identifier Oligonucleotides Gccgtttaagaagatccctg, supplied by Synthego Inc, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/resource+source+identifier+chemicals/pm37330910-206-2-10?v=Synthego+Inc
Average 86 stars, based on 1 article reviews
resource source identifier oligonucleotides gccgtttaagaagatccctg - by Bioz Stars, 2026-08
86/100 stars
  Buy from Supplier

86
Eurofins resource source identifier primer
Resource Source Identifier Primer, supplied by Eurofins, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/resource+source+identifier+chemicals/pm34856120-252-2-10?v=Eurofins
Average 86 stars, based on 1 article reviews
resource source identifier primer - by Bioz Stars, 2026-08
86/100 stars
  Buy from Supplier

86
Obio Technology Corp Ltd resource source identifier oligonucleotides
Resource Source Identifier Oligonucleotides, supplied by Obio Technology Corp Ltd, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/resource+source+identifier+chemicals/pm38382532-187-2-24?v=Obio+Technology+Corp+Ltd
Average 86 stars, based on 1 article reviews
resource source identifier oligonucleotides - by Bioz Stars, 2026-08
86/100 stars
  Buy from Supplier

86
Fisher Scientific resource source identifier chloroform fisher scientific bp11451 2 propanol
Resource Source Identifier Chloroform Fisher Scientific Bp11451 2 Propanol, supplied by Fisher Scientific, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/resource+source+identifier+chemicals/pm41105512-233-2-6?v=Fisher+Scientific
Average 86 stars, based on 1 article reviews
resource source identifier chloroform fisher scientific bp11451 2 propanol - by Bioz Stars, 2026-08
86/100 stars
  Buy from Supplier

86
Affinity Biosciences resource source identifier rabbit anti- fcer1g affinity biosciences df13263
Resource Source Identifier Rabbit Anti Fcer1g Affinity Biosciences Df13263, supplied by Affinity Biosciences, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/resource+source+identifier+chemicals/10__1016_slash_j__isci__2025__113687-615-33-40?v=Affinity+Biosciences
Average 86 stars, based on 1 article reviews
resource source identifier rabbit anti- fcer1g affinity biosciences df13263 - by Bioz Stars, 2026-08
86/100 stars
  Buy from Supplier

86
Partek resource source identifier org mm e g
Resource Source Identifier Org Mm E G, supplied by Partek, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/resource+source+identifier+chemicals/pm41100252-333-2-11?v=Partek
Average 86 stars, based on 1 article reviews
resource source identifier org mm e g - by Bioz Stars, 2026-08
86/100 stars
  Buy from Supplier

86
Fine Science Tools resource source identifier glad press n seal wrap glad 240611 000532 scissor handle forceps
Resource Source Identifier Glad Press N Seal Wrap Glad 240611 000532 Scissor Handle Forceps, supplied by Fine Science Tools, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/resource+source+identifier+chemicals/pm41528849-97-3-15?v=Fine+Science+Tools
Average 86 stars, based on 1 article reviews
resource source identifier glad press n seal wrap glad 240611 000532 scissor handle forceps - by Bioz Stars, 2026-08
86/100 stars
  Buy from Supplier

90
Stoelting inc reagent or resource source identifier anymaze
Reagent Or Resource Source Identifier Anymaze, supplied by Stoelting inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/resource+source+identifier+chemicals/pm39163865-131-2-6?v=Stoelting+inc
Average 90 stars, based on 1 article reviews
reagent or resource source identifier anymaze - by Bioz Stars, 2026-08
90/100 stars
  Buy from Supplier

Image Search Results